Review



whole brain marathon ready cdna library  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    TaKaRa whole brain marathon ready cdna library
    Whole Brain Marathon Ready Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 204 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/whole+brain+marathon+ready+cdna+library/Rat+Brain+Marathon+-Ready+cDNA/pm35914168-290-3-8
    Average 92 stars, based on 204 article reviews
    whole brain marathon ready cdna library - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    cDNA Library Assay:

    Article Title: Loss of Ca V 1.3 RNA editing enhances mouse hippocampal plasticity, learning, and memory.
    Article Snippet: L-type CaV1.3 calcium channels are expressed on the dendrites and soma of neurons, and there is a paucity of information about its role in hippocampal plasticity.. Here, by genetic targeting to ablate CaV1.3 RNA editing, we demonstrate that unedited CaV1.3 ΔECS mice exhibited improved learning and enhanced long-term memory, supporting a functional role of RNA editing in behavior.. Significantly, the editing paradox that functional recoding of CaV1.3 RNA editing sites slows Ca -dependent inactivation to increase Ca influx but reduces channel open probability to decrease Ca influx was resolved.

    Article Title: Humanized monoclonal antibody armanezumab specific to N-terminus of pathological tau: characterization and therapeutic potency
    Article Snippet: .. Gene encoding 0N4R tau protein was amplified from human whole brain Marathon®-Ready cDNA library (Clontech) using primers 5’- catatg gctgagccccgccaggagttcgaagtgatg (forward) and 5’- ctcgag tcacaaaccctgcttggccagggaggcagac (reverse) and cloned into the pET24a + E.coli expression vector in frame with 6xHis-tag at the C-terminus using restriction sites NdeI and XhoI. ..

    Article Title: Testing a MultiTEP-based combination vaccine to reduce Aβ and tau pathology in Tau22/5xFAD bigenic mice
    Article Snippet: To prepare two recombinant proteins, minigenes encoding 3Aβ 1–11 -MultiTEP or 3Tau 2–18 -MultiTEP were cloned into the modified Escherichia coli expression vector pET11 (for AV-1959R; Novagen, MA) or pET24a (for AV-1980R; Novagen, MA) in frame with 6xHis-Tag at the C-terminus. .. Gene encoding 2N4R tau protein was amplified from human whole brain Marathon®-Ready cDNA library (Clontech) using primers 5′-catatggctgagccccgccaggagttcgaagtgatg (forward) and 5′-ctcgagtcacaaaccctgcttggccagggaggcagac (reverse) and cloned into the pET24a + E. coli expression vector in frame with 6xHis-tag at the C-terminus using restriction sites NdeI and XhoI. ..

    Amplification:

    Article Title: Humanized monoclonal antibody armanezumab specific to N-terminus of pathological tau: characterization and therapeutic potency
    Article Snippet: .. Gene encoding 0N4R tau protein was amplified from human whole brain Marathon®-Ready cDNA library (Clontech) using primers 5’- catatg gctgagccccgccaggagttcgaagtgatg (forward) and 5’- ctcgag tcacaaaccctgcttggccagggaggcagac (reverse) and cloned into the pET24a + E.coli expression vector in frame with 6xHis-tag at the C-terminus using restriction sites NdeI and XhoI. ..

    Article Title: Testing a MultiTEP-based combination vaccine to reduce Aβ and tau pathology in Tau22/5xFAD bigenic mice
    Article Snippet: To prepare two recombinant proteins, minigenes encoding 3Aβ 1–11 -MultiTEP or 3Tau 2–18 -MultiTEP were cloned into the modified Escherichia coli expression vector pET11 (for AV-1959R; Novagen, MA) or pET24a (for AV-1980R; Novagen, MA) in frame with 6xHis-Tag at the C-terminus. .. Gene encoding 2N4R tau protein was amplified from human whole brain Marathon®-Ready cDNA library (Clontech) using primers 5′-catatggctgagccccgccaggagttcgaagtgatg (forward) and 5′-ctcgagtcacaaaccctgcttggccagggaggcagac (reverse) and cloned into the pET24a + E. coli expression vector in frame with 6xHis-tag at the C-terminus using restriction sites NdeI and XhoI. ..

    Clone Assay:

    Article Title: Humanized monoclonal antibody armanezumab specific to N-terminus of pathological tau: characterization and therapeutic potency
    Article Snippet: .. Gene encoding 0N4R tau protein was amplified from human whole brain Marathon®-Ready cDNA library (Clontech) using primers 5’- catatg gctgagccccgccaggagttcgaagtgatg (forward) and 5’- ctcgag tcacaaaccctgcttggccagggaggcagac (reverse) and cloned into the pET24a + E.coli expression vector in frame with 6xHis-tag at the C-terminus using restriction sites NdeI and XhoI. ..

    Article Title: Testing a MultiTEP-based combination vaccine to reduce Aβ and tau pathology in Tau22/5xFAD bigenic mice
    Article Snippet: To prepare two recombinant proteins, minigenes encoding 3Aβ 1–11 -MultiTEP or 3Tau 2–18 -MultiTEP were cloned into the modified Escherichia coli expression vector pET11 (for AV-1959R; Novagen, MA) or pET24a (for AV-1980R; Novagen, MA) in frame with 6xHis-Tag at the C-terminus. .. Gene encoding 2N4R tau protein was amplified from human whole brain Marathon®-Ready cDNA library (Clontech) using primers 5′-catatggctgagccccgccaggagttcgaagtgatg (forward) and 5′-ctcgagtcacaaaccctgcttggccagggaggcagac (reverse) and cloned into the pET24a + E. coli expression vector in frame with 6xHis-tag at the C-terminus using restriction sites NdeI and XhoI. ..

    Expressing:

    Article Title: Humanized monoclonal antibody armanezumab specific to N-terminus of pathological tau: characterization and therapeutic potency
    Article Snippet: .. Gene encoding 0N4R tau protein was amplified from human whole brain Marathon®-Ready cDNA library (Clontech) using primers 5’- catatg gctgagccccgccaggagttcgaagtgatg (forward) and 5’- ctcgag tcacaaaccctgcttggccagggaggcagac (reverse) and cloned into the pET24a + E.coli expression vector in frame with 6xHis-tag at the C-terminus using restriction sites NdeI and XhoI. ..

    Article Title: Testing a MultiTEP-based combination vaccine to reduce Aβ and tau pathology in Tau22/5xFAD bigenic mice
    Article Snippet: To prepare two recombinant proteins, minigenes encoding 3Aβ 1–11 -MultiTEP or 3Tau 2–18 -MultiTEP were cloned into the modified Escherichia coli expression vector pET11 (for AV-1959R; Novagen, MA) or pET24a (for AV-1980R; Novagen, MA) in frame with 6xHis-Tag at the C-terminus. .. Gene encoding 2N4R tau protein was amplified from human whole brain Marathon®-Ready cDNA library (Clontech) using primers 5′-catatggctgagccccgccaggagttcgaagtgatg (forward) and 5′-ctcgagtcacaaaccctgcttggccagggaggcagac (reverse) and cloned into the pET24a + E. coli expression vector in frame with 6xHis-tag at the C-terminus using restriction sites NdeI and XhoI. ..

    other:

    Article Title: Loss of Ca V 1.3 RNA editing enhances mouse hippocampal plasticity, learning, and memory
    Article Snippet: For human, Whole Brain Marathon-ReadyTM cDNA library (Clontech, Takara) was used.



    Similar Products

    92
    TaKaRa whole brain marathon ready cdna library
    Whole Brain Marathon Ready Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/whole+brain+marathon+ready+cdna+library/Rat+Brain+Marathon+-Ready+cDNA/pm35914168-290-3-8
    Average 92 stars, based on 1 article reviews
    whole brain marathon ready cdna library - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    93
    TaKaRa whole marathon ready cdna library
    Whole Marathon Ready Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/whole+brain+marathon+ready+cdna+library/Human+Brain%2C+Whole+Marathon+-Ready+cDNA/pmc11415962-234-16-20
    Average 93 stars, based on 1 article reviews
    whole marathon ready cdna library - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    TaKaRa pre transformed human brain matchmaker cdna library
    Pre Transformed Human Brain Matchmaker Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/whole+brain+marathon+ready+cdna+library/Human+Brain%2C+Whole+Marathon+-Ready+cDNA/pmc06368517-77-16-22
    Average 93 stars, based on 1 article reviews
    pre transformed human brain matchmaker cdna library - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    TaKaRa pre transformed human brain cdna library
    Pre Transformed Human Brain Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/whole+brain+marathon+ready+cdna+library/Human+Brain%2C+Whole+Marathon+-Ready+cDNA/10__1074_slash_jbc__ra118__001779-277-10-18
    Average 93 stars, based on 1 article reviews
    pre transformed human brain cdna library - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    TaKaRa human brain cdna library
    Human Brain Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/whole+brain+marathon+ready+cdna+library/Human+Brain%2C+Whole+Marathon+-Ready+cDNA/us09493529-138-11-17
    Average 93 stars, based on 1 article reviews
    human brain cdna library - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results